View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3231_high_25 (Length: 400)
Name: NF3231_high_25
Description: NF3231
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3231_high_25 |
 |  |
|
| [»] scaffold0543 (2 HSPs) |
 |  |  |
|
| [»] scaffold0492 (2 HSPs) |
 |  |  |
|
Alignment Details
Target: chr3 (Bit Score: 210; Significance: 1e-115; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 19 - 265
Target Start/End: Complemental strand, 49972012 - 49971766
Alignment:
| Q |
19 |
agaagacagaatcagtgctctcccagattcacttcttattcacattctttcttttcttcctacctaaaatgccgccgtcacaatcattctcttcttctcg |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||| |
|
|
| T |
49972012 |
agaagacagaatcagtgctctcccagattcacttcttattcacattctttcttttcttcctaccaaaaatgccgccgtcacaatcatcctcttcttctcg |
49971913 |
T |
 |
| Q |
119 |
caactcattctcaatttcgatgaaaatcataaaggnnnnnnnttatgcagggcacattgggaggacccagatattgttccggaatgtcttttatagcatc |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||| |
|
|
| T |
49971912 |
caactcattctcaatttcgatgaaaatcataaaggaaaaaaattatgcagggcacattgggaggacccagatattgttccgaaatgtcttttatcgcatc |
49971813 |
T |
 |
| Q |
219 |
ttacaaagtgttcacttaaaattgacagcagtctaagttggaagttt |
265 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49971812 |
ttacaaagtgttcacttaaaattgacagcagtctaagttggaagttt |
49971766 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 83; E-Value: 3e-39
Query Start/End: Original strand, 288 - 390
Target Start/End: Complemental strand, 49971695 - 49971593
Alignment:
| Q |
288 |
tagatacagatgcaaaagaacaaatgttcatggaattatctttgtgcgcaaggaattcaacagtgtgtcaacttttatttatttgaatactgccacaggt |
387 |
Q |
| |
|
||||||||||||||||| | |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
49971695 |
tagatacagatgcaaaacaccaaatgttcatggaattatctttgtgcgcaaggaattcggcagtgtgtcaacttttatttatttgcatactgccacaggt |
49971596 |
T |
 |
| Q |
388 |
tct |
390 |
Q |
| |
|
||| |
|
|
| T |
49971595 |
tct |
49971593 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0543 (Bit Score: 44; Significance: 6e-16; HSPs: 2)
Name: scaffold0543
Description:
Target: scaffold0543; HSP #1
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 19 - 78
Target Start/End: Complemental strand, 3969 - 3910
Alignment:
| Q |
19 |
agaagacagaatcagtgctctcccagattcacttcttattcacattctttcttttcttcc |
78 |
Q |
| |
|
||||||||||||||||||||| || |||||||||||| ||||||||||||||||||||| |
|
|
| T |
3969 |
agaagacagaatcagtgctctaccggattcacttctttatcacattctttcttttcttcc |
3910 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0543; HSP #2
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 308 - 375
Target Start/End: Complemental strand, 2066 - 1999
Alignment:
| Q |
308 |
caaatgttcatggaattatctttgtgcgcaaggaattcaacagtgtgtcaacttttatttatttgaat |
375 |
Q |
| |
|
||||||||||||||||||| ||||||| |||||||||||| ||||||||||||||||||||||| |
|
|
| T |
2066 |
caaatgttcatggaattatatttgtgcccaaggaattcaatcacatgtcaacttttatttatttgaat |
1999 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0492 (Bit Score: 44; Significance: 6e-16; HSPs: 2)
Name: scaffold0492
Description:
Target: scaffold0492; HSP #1
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 19 - 78
Target Start/End: Complemental strand, 5515 - 5456
Alignment:
| Q |
19 |
agaagacagaatcagtgctctcccagattcacttcttattcacattctttcttttcttcc |
78 |
Q |
| |
|
||||||||||||||||||||| || |||||||||||| ||||||||||||||||||||| |
|
|
| T |
5515 |
agaagacagaatcagtgctctaccggattcacttctttatcacattctttcttttcttcc |
5456 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0492; HSP #2
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 308 - 375
Target Start/End: Complemental strand, 3612 - 3545
Alignment:
| Q |
308 |
caaatgttcatggaattatctttgtgcgcaaggaattcaacagtgtgtcaacttttatttatttgaat |
375 |
Q |
| |
|
||||||||||||||||||| ||||||| |||||||||||| ||||||||||||||||||||||| |
|
|
| T |
3612 |
caaatgttcatggaattatatttgtgcccaaggaattcaatcacatgtcaacttttatttatttgaat |
3545 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University