View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3231_high_31 (Length: 376)
Name: NF3231_high_31
Description: NF3231
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3231_high_31 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 362; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 362; E-Value: 0
Query Start/End: Original strand, 1 - 366
Target Start/End: Complemental strand, 18020484 - 18020119
Alignment:
| Q |
1 |
ccggttctttgccaaatgaacttggaacacttcagcacttggagattctaaaactctcagacaatcagttgtctggaaatattcctgcagcattaggcaa |
100 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18020484 |
ccggttctttgccaaatgaactcggaacacttcagcacttggagattctaaaactctcagacaatcagttgtctggaaatattcctgcagcattaggcaa |
18020385 |
T |
|
| Q |
101 |
tctgtctcatttgaactggttgctgatggacggcaatttgtttttcggcgaaataccttctcagttaggatctctttcgagcttacagatagcaatggat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18020384 |
tctgtctcatttgaactggttgctgatggacggcaatttgtttttcggcgaaataccttctcagttaggatctctttcgagcttacagatagcaatggat |
18020285 |
T |
|
| Q |
201 |
ctcagttacaataatctttctggaagaataccgtctcggctcggcaatctcaatatgcttgagtatctctttctcaataacaaccaattggatggtgaaa |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18020284 |
ctcagttacaataatctttctggaagaataccgtctcggctcggcaatctcaatatgcttgagtatctctttctcaataacaaccaattggatggtgaaa |
18020185 |
T |
|
| Q |
301 |
ttccgagtacctttagcgcactttctagcttgatggggtgtaatttctcaaacaataacctctctg |
366 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18020184 |
ttccgagtacctttagcgcactttctagcttgatggggtgtaatttctcaaacaataacctctctg |
18020119 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University