View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3231_high_39 (Length: 354)
Name: NF3231_high_39
Description: NF3231
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3231_high_39 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 264; Significance: 1e-147; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 264; E-Value: 1e-147
Query Start/End: Original strand, 18 - 336
Target Start/End: Complemental strand, 2097386 - 2097068
Alignment:
| Q |
18 |
ctgggttggatcagcgacccaggctttgacaccgatggcgaaagcagggttgattgatttggaggagaacatggagacggatgctagctagaaatagagt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
2097386 |
ctgggttggatcagcgacccaggctttgacaccgatggcgaaagcagggttgattgatttggaggagaacatggagacagatgctagctagaaatagagt |
2097287 |
T |
|
| Q |
118 |
caattctgaagattaatcatgtgggagtttcaaaggctctttatctgaaggagtttttgaggnnnnnnnnacgagttttaggtctaagaaaaaccaaggt |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||| |||||||||||||||||||| || |
|
|
| T |
2097286 |
caattctgaagattaatcatgtgggagtttcaaaggctctttatctgaaggagtttttga-gttttttttacgagtcttaggtctaagaaaaaccaaagt |
2097188 |
T |
|
| Q |
218 |
ttggtctggc-tttagtttggcacgttgttgtgtggaccatttggaatttctgcaatgaaatgatttaatttctccaggggtcttggtttggctgtatca |
316 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2097187 |
ttggtctggcttttagtttggcacgttgttgtgtgaaccatttggaatttctgcaatgaaatgatttaatttctccaggggtcttggtttggctgtatca |
2097088 |
T |
|
| Q |
317 |
ttggttctctctgatgttgg |
336 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
2097087 |
ttggttctctctgatgttgg |
2097068 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University