View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3231_high_63 (Length: 296)
Name: NF3231_high_63
Description: NF3231
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3231_high_63 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 7 - 286
Target Start/End: Original strand, 56313755 - 56314025
Alignment:
| Q |
7 |
gctgcgggaaactctctgttagtctccgcttgtggtggcggcgggggcgccattttccctgtctcagcttnnnnnnnnnnnnnnnnntcagtgagctgtt |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||| |||||||||||| |
|
|
| T |
56313755 |
gctgcgggaaactctctgttagtctccgct---ggtggcggcgggggcgtcattttccctgtctcagcttcagcagcagcag------cagtgagctgtt |
56313845 |
T |
 |
| Q |
107 |
ccaatactgctaccagtgctgcaatgatgatggatgatctcaataggcttgtaagttatcaacaacagcaatattgttacaatgttcaaaacccacatct |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56313846 |
ccaatactgctaccagtgctgcaatgatgatggatgatctcaataggcttgtaagttatcaacaacagcaatattgttacaatgttcaaaacccacatct |
56313945 |
T |
 |
| Q |
207 |
caatcatccaaatccgaatcatttgtctacattgctgatgcaaccgatgttaccaaatcaatttccaactaccttctctg |
286 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
56313946 |
caatcatccaaatccgaatcatttgtctacattgctgatgcaaccaatgttaccaaatcaatttccaactaccttctctg |
56314025 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University