View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3231_high_64 (Length: 288)
Name: NF3231_high_64
Description: NF3231
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3231_high_64 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 245; Significance: 1e-136; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 245; E-Value: 1e-136
Query Start/End: Original strand, 19 - 283
Target Start/End: Original strand, 45270104 - 45270368
Alignment:
| Q |
19 |
aaatggcatgtacttcatgttaactctagtataaccatgtggaaaatgactgacattatttcaatccaaagatgatctatgcactcaactttattattca |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45270104 |
aaatggcatgtacttcatgttaactctagtataaccatgtggaaaatgactgacataatttgaatccaaagatgatctatgcactcaactttattattca |
45270203 |
T |
 |
| Q |
119 |
actcatttttaggcgaatgtatctacacataaacaatttcacgttcagctcaatgacgttgattgaaattgactttgtctcagaattggttgtaacttaa |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45270204 |
actcatttttaggcgaatgtatctacacataaacaatttcacgttcagctcaatgacgttgattgaaattgactttgtctcagaattggttgtaacttaa |
45270303 |
T |
 |
| Q |
219 |
gcaagtatttgtatcttttgaatccaagagtgtattttacgctcaaatttattgttcatctcact |
283 |
Q |
| |
|
||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||| |
|
|
| T |
45270304 |
gcaagaatttgtatcttttgaatccaagagtgaattttacgctcaaatttattgttcaactcact |
45270368 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University