View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3231_high_69 (Length: 278)
Name: NF3231_high_69
Description: NF3231
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3231_high_69 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 154; Significance: 1e-81; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 154; E-Value: 1e-81
Query Start/End: Original strand, 1 - 158
Target Start/End: Complemental strand, 4807104 - 4806947
Alignment:
| Q |
1 |
ttcaaagattgttgtgcacaagtcaaatttggaagcaaacaacttcgatcacaacacatgcgatctgataaagaaggatgaaatagactccaaattggat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
4807104 |
ttcaaagattgttgtgcacaagtcaaatttggaagcaaacaacttcgatcacaacacatgcgatctgataaagaaggatgaaatagactccaaattagat |
4807005 |
T |
|
| Q |
101 |
ggaggatcatgaacttctcttaaaggttcacaaagatataaataaggctcaaattctg |
158 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4807004 |
ggaggatcatgaacttctcttaaaggttcacaaagatataaataaggctcaaattctg |
4806947 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 201 - 263
Target Start/End: Complemental strand, 4806904 - 4806840
Alignment:
| Q |
201 |
gaatgtcttgaataaacttacttttccttatct--ctcttaaacttttctcttggagtggttact |
263 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||| |
|
|
| T |
4806904 |
gaatgtcttgaataaacttacttttccttatctctctcttaaacttttctctcggagtggttact |
4806840 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University