View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3231_high_69 (Length: 278)

Name: NF3231_high_69
Description: NF3231
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3231_high_69
NF3231_high_69
[»] chr3 (2 HSPs)
chr3 (1-158)||(4806947-4807104)
chr3 (201-263)||(4806840-4806904)


Alignment Details
Target: chr3 (Bit Score: 154; Significance: 1e-81; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 154; E-Value: 1e-81
Query Start/End: Original strand, 1 - 158
Target Start/End: Complemental strand, 4807104 - 4806947
Alignment:
1 ttcaaagattgttgtgcacaagtcaaatttggaagcaaacaacttcgatcacaacacatgcgatctgataaagaaggatgaaatagactccaaattggat 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||    
4807104 ttcaaagattgttgtgcacaagtcaaatttggaagcaaacaacttcgatcacaacacatgcgatctgataaagaaggatgaaatagactccaaattagat 4807005  T
101 ggaggatcatgaacttctcttaaaggttcacaaagatataaataaggctcaaattctg 158  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
4807004 ggaggatcatgaacttctcttaaaggttcacaaagatataaataaggctcaaattctg 4806947  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 201 - 263
Target Start/End: Complemental strand, 4806904 - 4806840
Alignment:
201 gaatgtcttgaataaacttacttttccttatct--ctcttaaacttttctcttggagtggttact 263  Q
    |||||||||||||||||||||||||||||||||  ||||||||||||||||| ||||||||||||    
4806904 gaatgtcttgaataaacttacttttccttatctctctcttaaacttttctctcggagtggttact 4806840  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University