View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3231_high_72 (Length: 272)
Name: NF3231_high_72
Description: NF3231
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3231_high_72 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 114; Significance: 7e-58; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 114; E-Value: 7e-58
Query Start/End: Original strand, 121 - 253
Target Start/End: Complemental strand, 27494043 - 27493910
Alignment:
| Q |
121 |
ctctttgtacccattatgaaatgataaaggcacaattgcttagtagtggtggagatacttaatagatcaagaataagtagtag-aacctaactctaattt |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||| |||||||||||||||| |
|
|
| T |
27494043 |
ctctttgtacccattatgaaatgataaaggcacaattgcttagtagtggtggagatacctaatagatcaagaataagcagtagaaacctaactctaattt |
27493944 |
T |
 |
| Q |
220 |
aacactactccaaaaatgtccatcccttacctaa |
253 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||| |
|
|
| T |
27493943 |
aacactactccaaaaatgtccaccccttacctaa |
27493910 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 137 - 204
Target Start/End: Complemental strand, 46965943 - 46965876
Alignment:
| Q |
137 |
tgaaatgataaaggcacaattgcttagtagtggtggagatacttaatagatcaagaataagtagtaga |
204 |
Q |
| |
|
|||| |||| ||||||||| ||||| ||| | ||||| ||| |||||||||||||||| ||||||||| |
|
|
| T |
46965943 |
tgaattgattaaggcacaagtgcttggtaatcgtggaaatatttaatagatcaagaatgagtagtaga |
46965876 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University