View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3231_high_85 (Length: 245)
Name: NF3231_high_85
Description: NF3231
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3231_high_85 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 128; Significance: 3e-66; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 128; E-Value: 3e-66
Query Start/End: Original strand, 70 - 239
Target Start/End: Original strand, 8176040 - 8176208
Alignment:
| Q |
70 |
gtcaaaacccaccggaaggtcgcaaaaagtctcacgggaagctttattcaacggtagcacaaggaagtatttatcttttaacaatggcagaga-ttagag |
168 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
8176040 |
gtcaaaacccaccggtaggtcgcaaaaagtctcacgggaagctttattcaacggtagcacaaggaagtatttatcttttaacaatggcagagagttagag |
8176139 |
T |
 |
| Q |
169 |
ttaacttcaaagaaattcttgtcttgccttaaagacacaaatccatgtcggcgtccagagccagtctctgc |
239 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||| | |||| |||| | ||||||||||||||| |
|
|
| T |
8176140 |
ttaacttcaaagaaattcttgtcttgccttaaag--acaaacctatgtgggcggcaagagccagtctctgc |
8176208 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 1 - 61
Target Start/End: Original strand, 8174817 - 8174878
Alignment:
| Q |
1 |
gcttgttaaccttgatccatcaactttgtaagagtcatccaagccaa-tcatccataattga |
61 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||| | |||||||||||| |
|
|
| T |
8174817 |
gcttgttaaccttgatccatcaactttgcaagagtcatccaagccaatttatccataattga |
8174878 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University