View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3231_high_88 (Length: 242)

Name: NF3231_high_88
Description: NF3231
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3231_high_88
NF3231_high_88
[»] chr3 (1 HSPs)
chr3 (39-134)||(46634931-46635025)


Alignment Details
Target: chr3 (Bit Score: 88; Significance: 2e-42; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 39 - 134
Target Start/End: Complemental strand, 46635025 - 46634931
Alignment:
39 ttatagagactcgtatggaagggacttcttgcaggactactcccctcaatctaaaatttcaatcgtttagattttctttttaattttcaatattct 134  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||    
46635025 ttatagagactcgtatggaagggacttcttgcaggactactcccctcaatctaaaatttc-atcgtttagattttctttttaattttcaatattct 46634931  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University