View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3231_high_99 (Length: 221)
Name: NF3231_high_99
Description: NF3231
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3231_high_99 |
 |  |
|
| [»] scaffold0168 (2 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0168 (Bit Score: 85; Significance: 1e-40; HSPs: 2)
Name: scaffold0168
Description:
Target: scaffold0168; HSP #1
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 20 - 104
Target Start/End: Complemental strand, 32502 - 32418
Alignment:
| Q |
20 |
taaccctaaccccaatcatgttgttgatgatgtaccatcatccaccacaaacctaaaacaactaatacaaatttccaatgaacct |
104 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32502 |
taaccctaaccccaatcatgttgttgatgatgtaccatcatccaccacaaacctaaaacaactaatacaaatttccaatgaacct |
32418 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0168; HSP #2
Raw Score: 58; E-Value: 1e-24
Query Start/End: Original strand, 142 - 207
Target Start/End: Complemental strand, 32377 - 32312
Alignment:
| Q |
142 |
tcgttgattccaagaaaccgcttgatggatccgatttcaagaatgatggtttagagaatgtgtctg |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||| |
|
|
| T |
32377 |
tcgttgattccaagaaaccgcttgatggatccgaattcaagaatgatggtttagagaaagtgtctg |
32312 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University