View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3231_low_62 (Length: 316)
Name: NF3231_low_62
Description: NF3231
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3231_low_62 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 60; Significance: 1e-25; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 71 - 141
Target Start/End: Original strand, 39195288 - 39195359
Alignment:
| Q |
71 |
ctacctaataagataagaaagagacgcaatataa-ttaactaatcaaacactcatatagtttttcttaagga |
141 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39195288 |
ctacctaataagacaagaaagagacgcaatataaattaactaatcaaacactcatatagtttttcttaagga |
39195359 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 15 - 66
Target Start/End: Original strand, 39195211 - 39195262
Alignment:
| Q |
15 |
tatggttaatactcgacgaaatgttgataagcatgaagtgtattcttattct |
66 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||| ||||||||||||||| |
|
|
| T |
39195211 |
tatggttaatactcgacgaaatggagataagcatgaggtgtattcttattct |
39195262 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University