View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3231_low_74 (Length: 286)
Name: NF3231_low_74
Description: NF3231
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3231_low_74 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 216; Significance: 1e-118; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 216; E-Value: 1e-118
Query Start/End: Original strand, 7 - 267
Target Start/End: Original strand, 1911500 - 1911764
Alignment:
| Q |
7 |
gtgagatgaaggggggaaaacaatgaagtgagaatctttcttttgcttggttggtatgtctcataagtcacacaacttgcatgtgaggtctataatctaa |
106 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1911500 |
gtgacatgaaggggggaaaacaatgaagtgagaatctttcttttgcttggttggtatgtctcataagtcacacaacttgcatgtgaggtctataatctaa |
1911599 |
T |
 |
| Q |
107 |
gttatataaaaaata----tatatgtgtataagttagatatgacgcattgtattttcatatgcttattcatggtccattttgacacatatatatgcttag |
202 |
Q |
| |
|
||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
1911600 |
gttatataaaaaatacttatatctgtgtataagttagatatgacgcattgtattttcatatgcttattcatggagcattttgacacatatatatgcttag |
1911699 |
T |
 |
| Q |
203 |
actttttgatttaatataatatacaagttcattagaatatgggtttaacaaatagcaactcctct |
267 |
Q |
| |
|
|||||||| |||||||||||||||||||||| || ||||||||||||||||||| |||||||||| |
|
|
| T |
1911700 |
actttttggtttaatataatatacaagttcaataaaatatgggtttaacaaataacaactcctct |
1911764 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University