View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3231_low_78 (Length: 275)
Name: NF3231_low_78
Description: NF3231
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3231_low_78 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 123; Significance: 3e-63; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 123; E-Value: 3e-63
Query Start/End: Original strand, 14 - 136
Target Start/End: Complemental strand, 19049135 - 19049013
Alignment:
| Q |
14 |
cagagaggtcacacatactgaaaacctgaccaacaaaagccggaccaccactgccaccggtgatgttttttccattgagccgcgatactcggaccgattt |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19049135 |
cagagaggtcacacatactgaaaacctgaccaacaaaagccggaccaccactgccaccggtgatgttttttccattgagccgcgatactcggaccgattt |
19049036 |
T |
|
| Q |
114 |
gggggaagagcgagttgactcgg |
136 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
19049035 |
gggggaagagcgagttgactcgg |
19049013 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 194 - 275
Target Start/End: Complemental strand, 19048955 - 19048874
Alignment:
| Q |
194 |
ttgcggaaggtagttgaggtgaagatgaaggtagagggggaggaggatgaggattgaagagagagatgaaatttgaagcggt |
275 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19048955 |
ttgcggaaggtagttgaggtgtagatgaaggtagagggggaggaggatgaggattgaagagagagatgaaatttgaagcggt |
19048874 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University