View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3231_low_81 (Length: 265)
Name: NF3231_low_81
Description: NF3231
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3231_low_81 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 17 - 265
Target Start/End: Complemental strand, 43514242 - 43513994
Alignment:
| Q |
17 |
caagctccgctacaccggtggccacacccgagtcctcgctctccctccacccatttctttctcaggtttgtttatcatcccaccaaactttcaatttaag |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||| |
|
|
| T |
43514242 |
caagctccgctacaccggtggccacacccgagtcctcgctctccctccacccatttctttctcaggtttgtttctcatctcaccaaactttcaatttaag |
43514143 |
T |
|
| Q |
117 |
cactcttaattcatcaatcaatgacacgttcatcagccacaacagtgacatattgatctatgtagaaatgatattattgaatttaaccacgtatgtctgt |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||| |
|
|
| T |
43514142 |
cactcttaattcatcaatcaatgacacgttcatcagacacaacagtgacatattgatctatgtagaaatgatattattgaatttaaccatgtatgtttgt |
43514043 |
T |
|
| Q |
217 |
gtttgacattgatccatgtcgaatgtagaggacattattgaatataatc |
265 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43514042 |
gtttgacactgatccatgtcgaatgtagaggacattattgaatataatc |
43513994 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University