View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3231_low_82 (Length: 265)
Name: NF3231_low_82
Description: NF3231
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3231_low_82 |
 |  |
|
| [»] chr5 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 121; Significance: 4e-62; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 121; E-Value: 4e-62
Query Start/End: Original strand, 141 - 265
Target Start/End: Complemental strand, 30758085 - 30757961
Alignment:
| Q |
141 |
cgggggtgcttcgaatttctaagtggaagcgagatttcaatactcattcacaaaggcaaactcatgcgtaggtttagatcaggctactggagcaacctca |
240 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
30758085 |
cgggggtgcttcgaatttctaagtggaagcgagatttcaatactcattcacaaaggcaaactcatgcctaggtttagatcaggctactggagcaacctca |
30757986 |
T |
 |
| Q |
241 |
gaagtattggcaggataaaactcgt |
265 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
30757985 |
gaagtattggcaggataaaactcgt |
30757961 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 14 - 87
Target Start/End: Complemental strand, 30758156 - 30758083
Alignment:
| Q |
14 |
atcaaagcaatggtaaacgagtcatcaacggtgtgttatttccctaggttgagggatttttagttcactgtcgg |
87 |
Q |
| |
|
|||||||||||||||||||| ||||||| | ||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
30758156 |
atcaaagcaatggtaaacgactcatcaatgacgtgttatttccctaggttgggggatttttagttcactgtcgg |
30758083 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University