View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3231_low_83 (Length: 264)
Name: NF3231_low_83
Description: NF3231
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3231_low_83 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 11 - 248
Target Start/End: Complemental strand, 30204032 - 30203794
Alignment:
| Q |
11 |
cagagatgcgggcagaaataatgatcaagctttcttttatttctttgaaagttaggtttcagcttaaatagctgattattgagattgtaatttatgtggg |
110 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
30204032 |
cagaaatgcgggcagaaataatgatcaagctttcttttatttctttgaaagttaggtttcagcttaaatagctggttattgagattgtaatttatgtggg |
30203933 |
T |
|
| Q |
111 |
cattcagaaatatgaccaggcaatt-ttttgtattgtcctcatttcattttcacaaataaatgatgggactcaattcattgcattctatgctaaatgagc |
209 |
Q |
| |
|
||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30203932 |
cattcagaaatatgaccaggcaatttttttatattgtcctcatttcattttcacaaataaatgatgggactcaattcattgcattctatgctaaatgagc |
30203833 |
T |
|
| Q |
210 |
acagcataaattataaataacacaagtccatggactatt |
248 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
30203832 |
acagcataaattataaatttcacaagtccatggactatt |
30203794 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University