View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3231_low_94 (Length: 244)
Name: NF3231_low_94
Description: NF3231
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3231_low_94 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 20 - 234
Target Start/End: Original strand, 30757471 - 30757685
Alignment:
| Q |
20 |
aatcagctcaccatgaagcttttcctgaatatttgaagtgtcatcagtaccgaatgaaattgtggcagggatatgctcttcattcacaatggcaataacc |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30757471 |
aatcagctcaccatgaagcttttcctgaatatttgaagtgtcatcagtaccgaatgaaattgtggcagggatatgctcttcattcacaatggcaataacc |
30757570 |
T |
 |
| Q |
120 |
gccttattagtaattggtgctgcaaaagctttagaagaacctataccatcaggatctttcttttcaacatatttcagagtcatttgcttccgagcatgtg |
219 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30757571 |
gccttattagtaattggcgctgcaaaagctttagaagaacctataccatcatgatcgttcttttcaacatatttcagagtcatttgcttccgagcatgtg |
30757670 |
T |
 |
| Q |
220 |
taggtttcttctcac |
234 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
30757671 |
taggtttcttctcac |
30757685 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University