View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3232_low_10 (Length: 292)
Name: NF3232_low_10
Description: NF3232
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3232_low_10 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 157; Significance: 2e-83; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 157; E-Value: 2e-83
Query Start/End: Original strand, 84 - 280
Target Start/End: Complemental strand, 40970670 - 40970467
Alignment:
| Q |
84 |
taaatgttaactttagcctatata--attatgttgaagtcctctaacatagttcataattatatttgttaatggacatacttgaattgaatacatattgt |
181 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40970670 |
taaatgttaactttagcctatatataattatgttgaagtcctctaacatagttcataattatatttgttaatggacatacttgaattgaatacatattgt |
40970571 |
T |
 |
| Q |
182 |
tttaaattgataaagaccca-----catacttaaaagacttaatacttgttcggtctcgtactgactttaacatcaaagtttgtttacaagtatccttaa |
276 |
Q |
| |
|
|||| ||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
40970570 |
tttagattgataaagacccatactcgacacttaaaagacttaatacttgttcggtctcgtactgactttaacatcaaagtttgtttaaaagtatccttaa |
40970471 |
T |
 |
| Q |
277 |
attc |
280 |
Q |
| |
|
|||| |
|
|
| T |
40970470 |
attc |
40970467 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 17 - 84
Target Start/End: Complemental strand, 40970798 - 40970731
Alignment:
| Q |
17 |
cacatgaggggtagaacgtgtcaataaaaaagcatgacatgtgtgagctcaaaatacatactatgaat |
84 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40970798 |
cacatgaggggtagaacgtgtcaataaaaaagcatgacatgtgtgagctcaaaatacatactatgaat |
40970731 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University