View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3232_low_11 (Length: 267)

Name: NF3232_low_11
Description: NF3232
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3232_low_11
NF3232_low_11
[»] chr3 (1 HSPs)
chr3 (12-226)||(25364864-25365078)


Alignment Details
Target: chr3 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 12 - 226
Target Start/End: Complemental strand, 25365078 - 25364864
Alignment:
12 atgaaagaactgcgcctaccctatagtaaagggtgattcatggtatgaacgtgagaaaaggttgaacctttttgaataacacgcaaaggtgttaaaagga 111  Q
    ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||    
25365078 atgaaagaactgcgcctactctatagtaaagggtgattcatggtatgaacgtgagaaaaggttgaacctttttgaagaacacgcaaaggtgttaaaagga 25364979  T
112 gagaatccaggtgaagagaaagagtagaataatgggatggtgtggattccgaggaatgcaaagtcaacgagattgaagctgccatggtgtgtatggttac 211  Q
    | ||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||    
25364978 gggaatccaggtgaagagaaaaagtagaataatgggatggtgtggattccgaggaatggaaagtcaacgagattgaagctgccatggtatgtatggttac 25364879  T
212 ttgaagaacaaggaa 226  Q
    |||||||||||||||    
25364878 ttgaagaacaaggaa 25364864  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University