View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3232_low_11 (Length: 267)
Name: NF3232_low_11
Description: NF3232
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3232_low_11 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 12 - 226
Target Start/End: Complemental strand, 25365078 - 25364864
Alignment:
| Q |
12 |
atgaaagaactgcgcctaccctatagtaaagggtgattcatggtatgaacgtgagaaaaggttgaacctttttgaataacacgcaaaggtgttaaaagga |
111 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
25365078 |
atgaaagaactgcgcctactctatagtaaagggtgattcatggtatgaacgtgagaaaaggttgaacctttttgaagaacacgcaaaggtgttaaaagga |
25364979 |
T |
|
| Q |
112 |
gagaatccaggtgaagagaaagagtagaataatgggatggtgtggattccgaggaatgcaaagtcaacgagattgaagctgccatggtgtgtatggttac |
211 |
Q |
| |
|
| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
25364978 |
gggaatccaggtgaagagaaaaagtagaataatgggatggtgtggattccgaggaatggaaagtcaacgagattgaagctgccatggtatgtatggttac |
25364879 |
T |
|
| Q |
212 |
ttgaagaacaaggaa |
226 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
25364878 |
ttgaagaacaaggaa |
25364864 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University