View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3232_low_9 (Length: 298)
Name: NF3232_low_9
Description: NF3232
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3232_low_9 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 263; Significance: 1e-147; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 263; E-Value: 1e-147
Query Start/End: Original strand, 11 - 281
Target Start/End: Original strand, 11424579 - 11424849
Alignment:
| Q |
11 |
gagatgaatgttgtacaatttggcagtggaatggtttagcagttctatttgtggttaatttaattgtttgctacaaacctgctattctgagaatattaag |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
11424579 |
gagatgaatgttgtacaatttggcagtggaatggtttagcagttctatttgtggttaatttaattgtttgctacaaacctgctattctgagaacattaag |
11424678 |
T |
|
| Q |
111 |
tgcatgttttggatggattgacaacaagtttgtcaatcacatgatttcaacaaaaattagactttgaagcttcaacaaaatcatggttctgccatgtttt |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
11424679 |
tgcatgttttggatggattgacaacaagtttgtcaatcacatgatttcaacaaaaattagactttgaagcttcaacaaaatcatggttctgccgtgtttt |
11424778 |
T |
|
| Q |
211 |
tgtcaaattcgtctttatttctgagcaaactagtggttttatgaagttgagtgctaccaatgagtacaact |
281 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11424779 |
tgtcaaattcgtctttatttctgagcaaactagtggttttatgaagttgagtgctaccaatgagtacaact |
11424849 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 21 - 71
Target Start/End: Complemental strand, 9322563 - 9322513
Alignment:
| Q |
21 |
ttgtacaatttggcagtggaatggtttagcagttctatttgtggttaattt |
71 |
Q |
| |
|
|||||||| |||| || ||||||||||||||||||||||| ||||| |||| |
|
|
| T |
9322563 |
ttgtacaagttggtagaggaatggtttagcagttctatttttggttcattt |
9322513 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 150 - 195
Target Start/End: Complemental strand, 3078965 - 3078920
Alignment:
| Q |
150 |
catgatttcaacaaaaattagactttgaagcttcaacaaaatcatg |
195 |
Q |
| |
|
|||||||| |||||||||| ||||||||||||||||| ||||||| |
|
|
| T |
3078965 |
catgattttgacaaaaattacactttgaagcttcaacagaatcatg |
3078920 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University