View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3234_high_11 (Length: 422)
Name: NF3234_high_11
Description: NF3234
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3234_high_11 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 332; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 332; E-Value: 0
Query Start/End: Original strand, 19 - 416
Target Start/End: Complemental strand, 44546649 - 44546252
Alignment:
| Q |
19 |
tctttccaccaagtttaccctttttctttgttgcacatgatgattcatnnnnnnnatattttacatacacatcatcctcaactatctcaagtacattaga |
118 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44546649 |
tctttccaccaagtttatcctttttctttgttgcacatgatgattcatcccccccatattttacatacacatcatcctcaactatctcaagtacattaga |
44546550 |
T |
 |
| Q |
119 |
ttttccatgacgcttcatatgcttcattaaaaacctatgtcgttcattttcttcttcattgctgttgctgtcgttgttttgttcctgaagatgaagcagc |
218 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44546549 |
ttttccatgacgcttcatatgcttcaataaaaacctatgtcgttcattttcttcttcattgctgttgctgtcgttgttttgttcctgaagatgaagcagc |
44546450 |
T |
 |
| Q |
219 |
tgagattgtataatactggatggaccatctgtgatctttatcaagtctgagtcggcttttggatcgttaatgtaaaatttgtgaa---gaaggttgtaga |
315 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||| |
|
|
| T |
44546449 |
tgagattgtataatactggatggaccatctgtgatctttatcaagtctgagtcggcttttggatcgttaatgtaaaatttgtgaagaagaaggtcgtaga |
44546350 |
T |
 |
| Q |
316 |
gctttttcttttgagtattagggtacctaatcttgtgaagaagaaggaaatcatataaatctttttcatgatcccatgttctctttctagggttcatctc |
415 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
44546349 |
gctttttcttttgagtattagggtccctaatcttgt---gaagaaggaaatcatataaatctttttcatgatcccatgttctctttctagggttcttctc |
44546253 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University