View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3234_high_33 (Length: 281)
Name: NF3234_high_33
Description: NF3234
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3234_high_33 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 159; Significance: 1e-84; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 159; E-Value: 1e-84
Query Start/End: Original strand, 72 - 266
Target Start/End: Original strand, 46864905 - 46865098
Alignment:
| Q |
72 |
tcatgattttcttctctctcattcataaagatgcacacttgtgatattgtggtcggctaatgtcattagcactctaatgtcaccgaatttctattcaaaa |
171 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||| ||| || |||||||||||||||||||||| |||||||||||||| |||| ||||| |
|
|
| T |
46864905 |
tcatgactttcttctctctcattcataaagatgcacacttgtgacattatgatcggctaatgtcattagcactccaatgtcaccgaattgctatccaaaa |
46865004 |
T |
|
| Q |
172 |
tatgttactttgtgcatgtggaacgcacttttgggttcagatagcgaagtgttgggttggatacattgaaattcaacacgtgccttctcccccat |
266 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46865005 |
tatgtta-tttgtgcatgtggaacgcacttttgggttcagatagcgaagtgttgggttggatacattgaaattcaacacgtgccttctcccccat |
46865098 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 16 - 55
Target Start/End: Original strand, 46864849 - 46864888
Alignment:
| Q |
16 |
aatatcatgtgtcattgatcaactataacatcacaagtgt |
55 |
Q |
| |
|
||||||||||| |||| ||||||||||||||||||||||| |
|
|
| T |
46864849 |
aatatcatgtgacattaatcaactataacatcacaagtgt |
46864888 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University