View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3234_high_38 (Length: 262)

Name: NF3234_high_38
Description: NF3234
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3234_high_38
NF3234_high_38
[»] chr1 (1 HSPs)
chr1 (197-243)||(116287-116333)


Alignment Details
Target: chr1 (Bit Score: 39; Significance: 0.0000000000004; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 197 - 243
Target Start/End: Original strand, 116287 - 116333
Alignment:
197 aatcaattctaccatttgattcatgtcttcttctgttaggaatccac 243  Q
    ||||||||||||||||||||||||||||||||| ||||| |||||||    
116287 aatcaattctaccatttgattcatgtcttcttccgttagaaatccac 116333  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University