View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3234_high_43 (Length: 250)
Name: NF3234_high_43
Description: NF3234
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3234_high_43 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 1 - 237
Target Start/End: Complemental strand, 26955007 - 26954766
Alignment:
| Q |
1 |
aattcagtcagaagagagttgatccaggatgcaataatggctaatgctttgtacttagccttggtggatgaccttgctactgctctt-----cgatgatt |
95 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
26955007 |
aattcattcagaagagagttgatccaggatgcaataatggctaatgctttgtacttagccttggtggatgaccttgctactgctctttgcttcgatgatt |
26954908 |
T |
 |
| Q |
96 |
tccacaagatgaggttggaactctagtagacaatgtgagcagatgtgtagtcatctttattatcagtccaatcagtatccttatatgcaatgagtgtaga |
195 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26954907 |
tccacaagatgaggttggaactctagtagacaatgtgagcagatgtgtagtcatctttattatcagtccaatcagtatccttatatgcaatgagtgtaga |
26954808 |
T |
 |
| Q |
196 |
agaattctgtttccgaagaaaaaggccatgaaaattgtacct |
237 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26954807 |
agaattctgtttccgaagaaaaaggccatgaaaattgtacct |
26954766 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University