View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3234_high_50 (Length: 236)

Name: NF3234_high_50
Description: NF3234
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3234_high_50
NF3234_high_50
[»] chr5 (1 HSPs)
chr5 (1-221)||(5182271-5182488)


Alignment Details
Target: chr5 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 1 - 221
Target Start/End: Original strand, 5182271 - 5182488
Alignment:
1 tatgtttttaatcatcaatttgctgaaagggttgccccttttgggcttccccgaccctccaaatatt-aaggaatatgaatatatgattaaatccaagtt 99  Q
    ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||    
5182271 tatgttttttatcatcaatttgctgaaagggttgccccttttgggcttccccgaccctccaaatatttaaggaatatgaatatatgattaaatccaagtt 5182370  T
100 tgaacctcttatcgtgcaatttagtcagtcatcctaaagttttttactagcctttcttcatatcccctctcaagtgaatatttaaatttgatcaatgtca 199  Q
    ||||||||| ||||||||||||||||    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
5182371 tgaacctctgatcgtgcaatttagtc----atcctaaagttttttactagcctttcttcatatcccctctcaagtgaatatttaaatttgatcaatgtca 5182466  T
200 tcatcaatttgcatgcaaattt 221  Q
    ||||||||||||||||||||||    
5182467 tcatcaatttgcatgcaaattt 5182488  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University