View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3234_high_52 (Length: 228)
Name: NF3234_high_52
Description: NF3234
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3234_high_52 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 127; Significance: 1e-65; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 127; E-Value: 1e-65
Query Start/End: Original strand, 21 - 216
Target Start/End: Complemental strand, 14567518 - 14567325
Alignment:
| Q |
21 |
tggtattacaaggggacttacaatactcgaaaataaacagaaaaggtagaaatccctagcagatgatataaggccttggagggctaggaatatatattta |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||| || ||| |||| |
|
|
| T |
14567518 |
tggtattacaaggggacttacaatactcgaaaataaacagaaaaggtagaaacccctagcagttgatataaggccttggagggcttgggata---atttt |
14567422 |
T |
|
| Q |
121 |
ataaatttatctatattcagat-ggatgctaatgctcatttcgtaacagttctttccaacccgaaattatgcagaatagtttgttaagatgctattg |
216 |
Q |
| |
|
| |||||||||||||||| || ||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||| |||||||| ||||| |
|
|
| T |
14567421 |
ttcaatttatctatattcatatgggatgctaatgctcatttcctaacagttctttccaaaccgaaattatgcagaatagttttttaagatggtattg |
14567325 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 15 - 91
Target Start/End: Complemental strand, 14574873 - 14574797
Alignment:
| Q |
15 |
aacctgtggtattacaaggggacttacaatactcgaaaataaacagaaaaggtagaaatccctagcagatgatataa |
91 |
Q |
| |
|
|||| |||| |||||||||||||||||| ||||| | ||||||||||||||||||||||| ||||||| |||||||| |
|
|
| T |
14574873 |
aaccagtggcattacaaggggacttacagtactctacaataaacagaaaaggtagaaatcactagcagttgatataa |
14574797 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University