View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3234_low_24 (Length: 334)
Name: NF3234_low_24
Description: NF3234
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3234_low_24 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 279; Significance: 1e-156; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 279; E-Value: 1e-156
Query Start/End: Original strand, 18 - 316
Target Start/End: Complemental strand, 19094767 - 19094470
Alignment:
| Q |
18 |
ccatcatgtcaaggaattcaagcatgatgacagagatgccttcttcaattccattcaatacattatacttatgtaaatttggtaccttttttatccgtta |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19094767 |
ccatcatgtcaaggaattcaagcatgatgacagagatgccttcttcaatttcattcaatacattatacttatgtaaatttggtaccttttttatccgtta |
19094668 |
T |
 |
| Q |
118 |
agaacgtcagtagtgaagctaggtcatcaaagagttatacagtagtctcattctgggttccaatgttccggtctacgacacaagtctatgtttttccctt |
217 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19094667 |
agaacgt-agtagtgaagctaggtcatcaaagagttatacagtagtcccattctgggttccaatgttccggtctacgacacaagtctatgtttttccctt |
19094569 |
T |
 |
| Q |
218 |
gcaaaggggttgcttcctaaggtttttggatgtgcaaagtctaacgtggtaaatatctcctatattataataaggcgaagaacggataagaactcatca |
316 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19094568 |
gcaaaggggttgcttcctaaggttttttgatgtgcaaagtctaacgtggtaaatatctcctatattataataaggcgaagaacggataagaactcatca |
19094470 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University