View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3234_low_32 (Length: 295)
Name: NF3234_low_32
Description: NF3234
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3234_low_32 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 259; Significance: 1e-144; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 259; E-Value: 1e-144
Query Start/End: Original strand, 16 - 278
Target Start/End: Complemental strand, 26375095 - 26374833
Alignment:
| Q |
16 |
atggtgtcaatcttgatgaagtaaaggtaattgattatcttcagaacatatttatgacttaactgtagtattaccgtagtttttagtaggttcttagaat |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
26375095 |
atggtgtcaatcttgatgaagtaaaggtaattgattatcttcagaacatatttatgacttaactgtagtattaccgtagtttttaataggttcttagaat |
26374996 |
T |
 |
| Q |
116 |
tttttaggccaatggacgttacttcaagaagatattaaacaatgatttcatattgggcaaacttaattttgataactaatttggaaacatggtgtactat |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26374995 |
tttttaggccaatggacgttacttcaagaagatattaaacaatgatttcatattgggcaaacttaattttgataactaatttggaaacatggtgtactat |
26374896 |
T |
 |
| Q |
216 |
attcgtatacattttgatctcgatgaggttggtctgctagaagcatgcagaccagcgtgctag |
278 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26374895 |
attcgtatacattttgatctcgatgaggttggtctgctagaagcatgcagaccagcgtgctag |
26374833 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University