View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3234_low_34 (Length: 283)
Name: NF3234_low_34
Description: NF3234
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3234_low_34 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 233; Significance: 1e-129; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 233; E-Value: 1e-129
Query Start/End: Original strand, 18 - 273
Target Start/End: Complemental strand, 48109515 - 48109262
Alignment:
| Q |
18 |
atttatttacgtagatgcgatctgcttcagacaccacttgaattgaagagttcaattttcatgcattttgtgcaaaattcattacattgattattgatat |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48109515 |
atttatttacgtagatgcgatctgcttcagacaccacttgaattgaagagttcaattttcatgcattttgtgcaaaattcattacattgattattgatat |
48109416 |
T |
 |
| Q |
118 |
tatagtacattagaatttgatttgacatattaattaacaatatcaatcgattattagcaaaacaacgaaaaatctaagaaatgatttcacgggacatcat |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48109415 |
tatagtacattagaatttgatttgacatattaattaagaatatcaatcgattattagc--aacaacgaaaaatctaagaaatgatttcacgggacatcat |
48109318 |
T |
 |
| Q |
218 |
tggagtctccaatccatatctgacaatattgctcaaagcattatattatgtctgtg |
273 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||| |||||||||| |
|
|
| T |
48109317 |
tggagtctccaatccatatctgacattattgctcaaagcattatagtatgtctgtg |
48109262 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University