View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3234_low_35 (Length: 283)

Name: NF3234_low_35
Description: NF3234
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3234_low_35
NF3234_low_35
[»] chr4 (6 HSPs)
chr4 (149-276)||(8758429-8758556)
chr4 (18-139)||(8758276-8758396)
chr4 (149-276)||(24213400-24213527)
chr4 (18-139)||(24213560-24213682)
chr4 (20-119)||(24213682-24213782)
chr4 (20-95)||(8758174-8758249)
[»] chr2 (3 HSPs)
chr2 (18-137)||(41878645-41878764)
chr2 (149-276)||(41878483-41878610)
chr2 (20-114)||(41878769-41878863)


Alignment Details
Target: chr4 (Bit Score: 116; Significance: 5e-59; HSPs: 6)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 116; E-Value: 5e-59
Query Start/End: Original strand, 149 - 276
Target Start/End: Original strand, 8758429 - 8758556
Alignment:
149 ttctttaactagattagaagcctgtgcttcttgctttgaaagcttcagtgcctcttcttccatcttcttagttgttgcagcaacttcgcgttccttttca 248  Q
    ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||    
8758429 ttctttagctagattagaagcctgtgcttcttgctttgaaagcttcagtgcctcttcttccatcttcttagttgttgcagcagcttcgcgttccttttca 8758528  T
249 gcttccactcttgcctcttcctttgctt 276  Q
    |||||||||||| |||||||||||||||    
8758529 gcttccactctttcctcttcctttgctt 8758556  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 114; E-Value: 7e-58
Query Start/End: Original strand, 18 - 139
Target Start/End: Original strand, 8758276 - 8758396
Alignment:
18 tgttgcacctttggtttctcatcctcatcaggattttgatttgttgtagcaacctgtgggcttaacttttgccttgaaaccctgcacgaaaagctttagc 117  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||    
8758276 tgttgcacctttggtttctcatcctcatcaggattttgatttgttgtagcaacctgtgggcttaacttttgccttgaaaccctgcacg-aaagctttagc 8758374  T
118 cttgttcaaaatgtcttctacc 139  Q
    ||||||||||||||||||||||    
8758375 cttgttcaaaatgtcttctacc 8758396  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 112; E-Value: 1e-56
Query Start/End: Original strand, 149 - 276
Target Start/End: Complemental strand, 24213527 - 24213400
Alignment:
149 ttctttaactagattagaagcctgtgcttcttgctttgaaagcttcagtgcctcttcttccatcttcttagttgttgcagcaacttcgcgttccttttca 248  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||| ||||||||    
24213527 ttctttaactagattagaagcctgtgcttcttgctttgaaagcttcagtgcctcttcttccagcttcttagttgttgcagcagcttcgcgtgccttttca 24213428  T
249 gcttccactcttgcctcttcctttgctt 276  Q
    |||||||||||||||||||||| |||||    
24213427 gcttccactcttgcctcttcctctgctt 24213400  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 107; E-Value: 1e-53
Query Start/End: Original strand, 18 - 139
Target Start/End: Complemental strand, 24213682 - 24213560
Alignment:
18 tgttgcacctttggtttctcatcctcatcaggattttgatttgttgtagcaacctgtgggcttaacttttgccttg-aaaccctgcacgaaaagctttag 116  Q
    ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||    
24213682 tgttgcaactttggtttctcatcctcatcaggattttgatttgttgtagcaacctgtgagcttaacttttgccttgaaaaccctgcacgaaaagctttag 24213583  T
117 ccttgttcaaaatgtcttctacc 139  Q
    |||||||||||||||||||||||    
24213582 ccttgttcaaaatgtcttctacc 24213560  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #5
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 20 - 119
Target Start/End: Complemental strand, 24213782 - 24213682
Alignment:
20 ttgcacctttggtttctcatcctcatcaggattttgatttgttgtagcaacctgtgggcttaacttttgccttg-aaaccctgcacgaaaagctttagcc 118  Q
    ||||||||||||  |||||||||||||||| |||||  ||| |||||||||||||| ||| ||||||| || || ||||||||||| |||| |||| |||    
24213782 ttgcacctttgggctctcatcctcatcaggcttttggattgctgtagcaacctgtgagctgaactttttccatgaaaaccctgcaccaaaaccttttgcc 24213683  T
119 t 119  Q
    |    
24213682 t 24213682  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #6
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 20 - 95
Target Start/End: Original strand, 8758174 - 8758249
Alignment:
20 ttgcacctttggtttctcatcctcatcaggattttgatttgttgtagcaacctgtgggcttaacttttgccttgaa 95  Q
    |||||||||||| ||||||||||||||||| |||||  ||| ||||||||||| || | | |||||||||| ||||    
8758174 ttgcacctttgggttctcatcctcatcaggcttttggattgctgtagcaacctttgagttgaacttttgccatgaa 8758249  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 112; Significance: 1e-56; HSPs: 3)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 112; E-Value: 1e-56
Query Start/End: Original strand, 18 - 137
Target Start/End: Complemental strand, 41878764 - 41878645
Alignment:
18 tgttgcacctttggtttctcatcctcatcaggattttgatttgttgtagcaacctgtgggcttaacttttgccttgaaaccctgcacgaaaagctttagc 117  Q
    ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||    
41878764 tgttgcaactttggtttctcatcctcatcaggattttgatttgttgtagcaacctgtgtgcttaacttttgccttgaaaccctgcacgaaaagctttagc 41878665  T
118 cttgttcaaaatgtcttcta 137  Q
    ||||||||||||||||||||    
41878664 cttgttcaaaatgtcttcta 41878645  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 108; E-Value: 3e-54
Query Start/End: Original strand, 149 - 276
Target Start/End: Complemental strand, 41878610 - 41878483
Alignment:
149 ttctttaactagattagaagcctgtgcttcttgctttgaaagcttcagtgcctcttcttccatcttcttagttgttgcagcaacttcgcgttccttttca 248  Q
    ||||||| ||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||    
41878610 ttctttagctagattagaagcttgtgcttcttgctttgaaagctttagtgcctcttcttccatcttcttagttgttgcagcagcttcgcgttccttttca 41878511  T
249 gcttccactcttgcctcttcctttgctt 276  Q
    |||||||||||||||||||||| |||||    
41878510 gcttccactcttgcctcttcctctgctt 41878483  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 20 - 114
Target Start/End: Complemental strand, 41878863 - 41878769
Alignment:
20 ttgcacctttggtttctcatcctcatcaggattttgatttgttgtagcaacctgtgggcttaacttttgccttg-aaaccctgcacgaaaagcttt 114  Q
    |||||||||||| ||||||||||||| ||| |||||  ||| |||||||||||||| ||| ||||||| || || ||||||||||| |||| ||||    
41878863 ttgcacctttgggttctcatcctcat-aggcttttggattgctgtagcaacctgtgagctgaacttttcccatgaaaaccctgcaccaaaaccttt 41878769  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University