View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3234_low_36 (Length: 281)

Name: NF3234_low_36
Description: NF3234
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3234_low_36
NF3234_low_36
[»] chr3 (2 HSPs)
chr3 (72-266)||(46864905-46865098)
chr3 (16-55)||(46864849-46864888)


Alignment Details
Target: chr3 (Bit Score: 159; Significance: 1e-84; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 159; E-Value: 1e-84
Query Start/End: Original strand, 72 - 266
Target Start/End: Original strand, 46864905 - 46865098
Alignment:
72 tcatgattttcttctctctcattcataaagatgcacacttgtgatattgtggtcggctaatgtcattagcactctaatgtcaccgaatttctattcaaaa 171  Q
    |||||| ||||||||||||||||||||||||||||||||||||| ||| || |||||||||||||||||||||| |||||||||||||| |||| |||||    
46864905 tcatgactttcttctctctcattcataaagatgcacacttgtgacattatgatcggctaatgtcattagcactccaatgtcaccgaattgctatccaaaa 46865004  T
172 tatgttactttgtgcatgtggaacgcacttttgggttcagatagcgaagtgttgggttggatacattgaaattcaacacgtgccttctcccccat 266  Q
    ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
46865005 tatgtta-tttgtgcatgtggaacgcacttttgggttcagatagcgaagtgttgggttggatacattgaaattcaacacgtgccttctcccccat 46865098  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 16 - 55
Target Start/End: Original strand, 46864849 - 46864888
Alignment:
16 aatatcatgtgtcattgatcaactataacatcacaagtgt 55  Q
    ||||||||||| |||| |||||||||||||||||||||||    
46864849 aatatcatgtgacattaatcaactataacatcacaagtgt 46864888  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University