View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3234_low_48 (Length: 247)
Name: NF3234_low_48
Description: NF3234
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3234_low_48 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 1 - 229
Target Start/End: Complemental strand, 43394020 - 43393774
Alignment:
| Q |
1 |
cattgatgtttgcacttgaacttttagaaagaacaagaaccacataaagtcttgtaagaaaatcttattagtagacctactagaagtcacttacacctct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43394020 |
cattgatgtttgcacttgaacttttagaaagaacaagaaccacataaagtcttgtaagaaaatcttattagtagacctactagaagtcacttacacctct |
43393921 |
T |
 |
| Q |
101 |
ttcaaaaagtcacttacaccaaaatgtgcatcatatc------------------taaaagtaccatcaaaatataacaatcaaagaataaaattcacag |
182 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43393920 |
ttcaaaaagtcacttacaccaaaatgtacatcatatctactcaacaattaaagaataaaagtaccatcaaaatataacaatcaaagaataaaattcacag |
43393821 |
T |
 |
| Q |
183 |
gagcatagagataattttgcctacattttagaagtactattgttcgt |
229 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43393820 |
gagcatagagataattttgcctacattttagaagtactattgttcgt |
43393774 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University