View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3234_low_50 (Length: 238)
Name: NF3234_low_50
Description: NF3234
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3234_low_50 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 208; Significance: 1e-114; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 15 - 222
Target Start/End: Original strand, 46677795 - 46678002
Alignment:
| Q |
15 |
agaatgaacaaaagtttgattcaaaattggcagcaaaatggggtcttttggattggttaactcacggtggttccactcccttaattgatatctttagtca |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46677795 |
agaatgaacaaaagtttgattcaaaattggcagcaaaatggggtcttttggattggttaactcacggtggttccactcccttaattgatatctttagtca |
46677894 |
T |
 |
| Q |
115 |
atcctctggagatatggttgatttccatcttgctactgttactcaagcacttaattgtcaagataattaccttaggatacaggtaattagatttcataac |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46677895 |
atcctctggagatatggttgatttccatcttgctactgttactcaagcacttaattgtcaagataattaccttaggatacaggtaattagatttcataac |
46677994 |
T |
 |
| Q |
215 |
ttatatat |
222 |
Q |
| |
|
|||||||| |
|
|
| T |
46677995 |
ttatatat |
46678002 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 15 - 199
Target Start/End: Original strand, 46681743 - 46681927
Alignment:
| Q |
15 |
agaatgaacaaaagtttgattcaaaattggcagcaaaatggggtcttttggattggttaactcacggtggttccactcccttaattgatatctttagtca |
114 |
Q |
| |
|
|||||||||||||||| || | ||| ||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||| || || |||||||| |
|
|
| T |
46681743 |
agaatgaacaaaagttcaatgcgaaaatggcagcaaaatggggtctgctggattggttaactcacggtggttcgactcccttaatcgacatgtttagtca |
46681842 |
T |
 |
| Q |
115 |
atcctctggagatatggttgatttccatcttgctactgttactcaagcacttaattgtcaagataattaccttaggatacaggta |
199 |
Q |
| |
|
||| || | |||||||||||||||||||||||| | || |||| ||||||||||| ||| |||||||||| |||||||||||| |
|
|
| T |
46681843 |
atcatcagctgatatggttgatttccatcttgctgccgtcactcgagcacttaattcacaacataattacctaaggatacaggta |
46681927 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University