View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3234_low_51 (Length: 238)
Name: NF3234_low_51
Description: NF3234
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3234_low_51 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 221; Significance: 1e-122; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 221; E-Value: 1e-122
Query Start/End: Original strand, 7 - 235
Target Start/End: Complemental strand, 27715854 - 27715626
Alignment:
| Q |
7 |
attaaaagagactatcagacaattgtataagccagtattgaggagccttcatccaataaatggcacatatgagaaacagttaatgtaggggagaagataa |
106 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
27715854 |
attaaaagagaccatcagacaattgtataagccagtattgaggagccttcatccaataaatggcacataggagaaacagttaatgtaggggagaagataa |
27715755 |
T |
 |
| Q |
107 |
ggaacaaatttcaaagccaaaatttgatcaacatgacatattctcaactcatgctgctactgacaggcccgttaccgagtttttagtggcctaggatgaa |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27715754 |
ggaacaaatttcaaagccaaaatttgatcaacatgacatattctcaactcatgctgctactgacaggcccgttaccgagtttttagtggcctaggatgaa |
27715655 |
T |
 |
| Q |
207 |
tctaaaatgtgagccttaagtttttatta |
235 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
27715654 |
tctaaaatgtgagccttaagtttttatta |
27715626 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University