View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3234_low_52 (Length: 237)
Name: NF3234_low_52
Description: NF3234
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3234_low_52 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 140; Significance: 2e-73; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 34 - 221
Target Start/End: Original strand, 53033471 - 53033665
Alignment:
| Q |
34 |
tttgctgtgactttatcctatttctgatctgcactgttattatgcatgcagtgagttacctactcctaccttattattattaccaccccctttccaaaca |
133 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53033471 |
tttgcggtgactttatcctatttctgatctgcactgttattatgcatgcagt----tacctactcctaccttattattattaccaccccctttccaaaca |
53033566 |
T |
|
| Q |
134 |
aaaag-----------tatttcaaatttaaatttcaacaggtggatatggcaccctcgaagaacttttggaaattattacctgggctcaactaggtatc |
221 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53033567 |
aaaagtattactaatctatttcaaatttaaatttcaacaggtggatatggcaccctcgaagaacttttggaaattattacctgggctcaactaggtatc |
53033665 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 160 - 214
Target Start/End: Complemental strand, 25026543 - 25026489
Alignment:
| Q |
160 |
caggtggatatggcaccctcgaagaacttttggaaattattacctgggctcaact |
214 |
Q |
| |
|
||||||||||||| ||||| |||||| | ||||||||||||| ||||||||||| |
|
|
| T |
25026543 |
caggtggatatggaacccttgaagaattgctggaaattattacttgggctcaact |
25026489 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University