View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3234_low_54 (Length: 236)
Name: NF3234_low_54
Description: NF3234
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3234_low_54 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 1 - 221
Target Start/End: Original strand, 5182271 - 5182488
Alignment:
| Q |
1 |
tatgtttttaatcatcaatttgctgaaagggttgccccttttgggcttccccgaccctccaaatatt-aaggaatatgaatatatgattaaatccaagtt |
99 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
5182271 |
tatgttttttatcatcaatttgctgaaagggttgccccttttgggcttccccgaccctccaaatatttaaggaatatgaatatatgattaaatccaagtt |
5182370 |
T |
|
| Q |
100 |
tgaacctcttatcgtgcaatttagtcagtcatcctaaagttttttactagcctttcttcatatcccctctcaagtgaatatttaaatttgatcaatgtca |
199 |
Q |
| |
|
||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5182371 |
tgaacctctgatcgtgcaatttagtc----atcctaaagttttttactagcctttcttcatatcccctctcaagtgaatatttaaatttgatcaatgtca |
5182466 |
T |
|
| Q |
200 |
tcatcaatttgcatgcaaattt |
221 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
5182467 |
tcatcaatttgcatgcaaattt |
5182488 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University