View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3235_low_17 (Length: 226)
Name: NF3235_low_17
Description: NF3235
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3235_low_17 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 25 - 211
Target Start/End: Original strand, 1715247 - 1715433
Alignment:
| Q |
25 |
atttaggtgcttcagtttttggaacgtttgattcttgacatggtatcgagttaaccatgtagtttagagttcaatccttattgccttcatggcaatattg |
124 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1715247 |
atttaggtgcttcagtttttggaacgtttgattcttgacatggtatcgagttaaccatgtagtttagagttcaatccttattgccttcatggcaatattg |
1715346 |
T |
 |
| Q |
125 |
ggtatgtgtgtgcttaagcttaaacttttagaatagttagttcatgacaaaaagaacacacattaccaaaccagcctaatcgtctgt |
211 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1715347 |
gatatgtgtgtgcttaagcttaaacttttagaatagttagttcatgacaaaaagaacacacattaccaaaccagcctaatcgtctgt |
1715433 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University