View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3235_low_9 (Length: 265)
Name: NF3235_low_9
Description: NF3235
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3235_low_9 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 237; Significance: 1e-131; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 237; E-Value: 1e-131
Query Start/End: Original strand, 13 - 249
Target Start/End: Original strand, 55162506 - 55162742
Alignment:
| Q |
13 |
atcatagctagagggcacaatatattctgggaagaccctaaatacaatcctgcatgggttcttaaccttacaggtacacagttaagatctgctgtgaatt |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55162506 |
atcatagctagagggcacaatatattctgggaagaccctaaatacaatcctgcatgggttcttaaccttacaggtacacagttaagatctgctgtgaatt |
55162605 |
T |
 |
| Q |
113 |
cacgaattcaaagtctcatgaaccaatacaaaacagaattcatacattgggatatcagtaacgaaatgcttcattttgatttctacgaacaaaggcttgg |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55162606 |
cacgaattcaaagtctcatgaaccaatacaaaacagaattcatacattgggatatcagtaacgaaatgcttcattttgatttctacgaacaaaggcttgg |
55162705 |
T |
 |
| Q |
213 |
acccaatgctacatttcatttctttgaggcagcacat |
249 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55162706 |
acccaatgctacatttcatttctttgaggcagcacat |
55162742 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University