View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3237_high_104 (Length: 257)
Name: NF3237_high_104
Description: NF3237
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3237_high_104 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 156; Significance: 6e-83; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 156; E-Value: 6e-83
Query Start/End: Original strand, 8 - 187
Target Start/End: Complemental strand, 4365928 - 4365749
Alignment:
| Q |
8 |
gatatgaacttaaagtttggttccgaatatgaactttgtacatgcttaaaaagaaagaaagatatttgtttagatgaactagagaaatcctgaaaactac |
107 |
Q |
| |
|
||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||| |
|
|
| T |
4365928 |
gatatgaacttgaagtttggttccggatatgaactttgtacatgcttaaaaagaaagaaagatacttgtttagatgaactagagaaagcctgaaaactac |
4365829 |
T |
|
| Q |
108 |
tgaacaaaacatgttcagtgcgtgatttttcataaattcttggaacaatatttttagacgggaccaattgcatcatgttc |
187 |
Q |
| |
|
|| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4365828 |
tgcacaaaacatgttcagtgtgtgatttttcataaattcttggaacaatatttttagacgggaccaattgcatcatgttc |
4365749 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University