View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3237_high_115 (Length: 250)
Name: NF3237_high_115
Description: NF3237
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3237_high_115 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 154; Significance: 9e-82; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 154; E-Value: 9e-82
Query Start/End: Original strand, 1 - 232
Target Start/End: Complemental strand, 45214407 - 45214179
Alignment:
| Q |
1 |
tggctttctttcatgttgtgagagtaaatgttcatcattggttagtcatattgaccatatattataatctttgttggtgacaatnnnnnnnn-tgttgat |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||| ||||||| |
|
|
| T |
45214407 |
tggctttctttcatgttgtgagagtaaatgttgatcattggttagtcatattgaccatata-----atctttgttggtgacaataaaaaaaaatgttgat |
45214313 |
T |
|
| Q |
100 |
caatagtgaaatttggtgttctataaaccatttgttttttcacaagggacaatatgcttgaccaaaggtaggagtcatttttgatatcgctctcaaccac |
199 |
Q |
| |
|
|||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
45214312 |
caatagtgaactttggtgttctataaacaatttgttttttcacaagggacaatatgcttgaccaaaggtgggagtcatttttgatatcgctctcaaccac |
45214213 |
T |
|
| Q |
200 |
agatgaagatgtcgttcc-ttcccatatatttat |
232 |
Q |
| |
|
||||| |||||||||||| ||||||||||||||| |
|
|
| T |
45214212 |
agatggagatgtcgttcctttcccatatatttat |
45214179 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University