View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3237_high_125 (Length: 243)
Name: NF3237_high_125
Description: NF3237
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3237_high_125 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 70; Significance: 1e-31; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 15 - 132
Target Start/End: Complemental strand, 44555266 - 44555154
Alignment:
| Q |
15 |
gaatatcaatgtcatgattcatgaggaactcnnnnnnnnnnnnnaacttatgttttctacttgtcaatgcctagtatcttgagatacctactaagattcc |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
44555266 |
gaatatcaatgtcatgattcatgaggaactc-----ttttttttaacttatgttttctacttgtcaatgcctagtatcttgagatatctactaagattcc |
44555172 |
T |
 |
| Q |
115 |
ttagcaaaagtaatgaat |
132 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
44555171 |
ttagcaaaagtaatgaat |
44555154 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 176 - 220
Target Start/End: Complemental strand, 44555112 - 44555068
Alignment:
| Q |
176 |
gtctttttgccactatatgttttttaaagtgaattttctttgtca |
220 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44555112 |
gtctttttgccactatatgttttttaaagtgaattttctttgtca |
44555068 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University