View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3237_high_133 (Length: 237)
Name: NF3237_high_133
Description: NF3237
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3237_high_133 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 18 - 237
Target Start/End: Complemental strand, 35608726 - 35608507
Alignment:
| Q |
18 |
gaagaggacatggacaaggagctggtggattagggatgccaaagaaaggacaaggatggttgtgaactttggttttcccaaactggtcaagatagttcag |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35608726 |
gaagaggacatggacaaggagctggtggattagggatgccaaagaaaggacaaggatggttgtgaactttggttttcccaaactggtcaagatagttcag |
35608627 |
T |
 |
| Q |
118 |
aaactcaaggacatgagaaccactgcatagggctaatgagagtggtggacggtggtttctgagatactgacagaatgtgttccagtctcttctcttttgg |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35608626 |
aaactcaaggacatgagaaccactgcatagggctaatgagagtggtggacggtggtttctgagatactgacagaatgtgttccagtctcttctcttttgg |
35608527 |
T |
 |
| Q |
218 |
ttttcataacggcttgaagt |
237 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
35608526 |
ttttcataacggcttgaagt |
35608507 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 170 - 217
Target Start/End: Complemental strand, 47836558 - 47836511
Alignment:
| Q |
170 |
tggtttctgagatactgacagaatgtgttccagtctcttctcttttgg |
217 |
Q |
| |
|
|||||||| | |||||| |||||||||||||||||||| ||||||||| |
|
|
| T |
47836558 |
tggtttcttaaatactggcagaatgtgttccagtctctcctcttttgg |
47836511 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University