View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3237_high_142 (Length: 215)
Name: NF3237_high_142
Description: NF3237
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3237_high_142 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 1 - 215
Target Start/End: Original strand, 40187817 - 40188031
Alignment:
| Q |
1 |
atattgagagggacttgttgcatccactatacaagaatgtggtctctgccttctccattttttggtgaaacacacaggtcnnnnnnnggatgacaacaac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
40187817 |
atattgagagggacttgttgcatccactatacaagaatgtggtctctgccttctccattttttggtgaaacacacaggtctttttttggatgacaacaac |
40187916 |
T |
|
| Q |
101 |
tattttccaatagggttttcaattatttattatcatacaaaagagtgtgataagtgagaacacactcttaacacaaaagcnnnnnnnngggaatgaaagg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
40187917 |
tattttccaatagggttttcaattatttattatcatacaaaagagtgtgataagtgagaacacactcttaacacaaaagcaaaaaaaagggaatgaaagg |
40188016 |
T |
|
| Q |
201 |
agcgtagaataaagc |
215 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
40188017 |
agcgtagaataaagc |
40188031 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University