View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3237_high_145 (Length: 208)
Name: NF3237_high_145
Description: NF3237
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3237_high_145 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 57; Significance: 5e-24; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 57; E-Value: 5e-24
Query Start/End: Original strand, 98 - 171
Target Start/End: Complemental strand, 31798862 - 31798787
Alignment:
| Q |
98 |
aattgattttaattgctagttcgattgctcagtagaacaattcttgcaaga--ttttgtttatataattcaagtag |
171 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||| |
|
|
| T |
31798862 |
aattgattttaattactagttcgattgctcagtagaacaattcttgcaagattttttttttatataattcaagtag |
31798787 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University