View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3237_high_31 (Length: 469)
Name: NF3237_high_31
Description: NF3237
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3237_high_31 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 433; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 433; E-Value: 0
Query Start/End: Original strand, 1 - 453
Target Start/End: Original strand, 49760453 - 49760905
Alignment:
| Q |
1 |
gaatatttattacttattttccctgtaggcgaggttttgcagccgcctctgatgtttcagctagagttggattaggtagtatagcccatggccacggaaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49760453 |
gaatatttattacttattttccctgtaggcgaggttttgcagccgcctctgatgtttcagctagagttggattaggtagtatagcccatggccacggaaa |
49760552 |
T |
|
| Q |
101 |
gctgggaagccttgaagagaagcacatgtctagagatggccaagaggcctgttcggcttgggcaccagacccagaaaccagatactaccgtcccatcaat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
49760553 |
gctgggaagccttgaagagaagcacatgtctaaagatggccaagaggcctgttcggcttgggcaccagacccagaatccggatactaccgtcccatcaat |
49760652 |
T |
|
| Q |
201 |
tacactcctaaaattgacccggtggagctccgacaaatgctactcaaacgcaataccagatcatcccaatagagctaggagagttgcatgctacaattac |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
49760653 |
tacactcctaaaattgacccggtggagctccgacaaatgctactcaaacgcaataccagatcatcccaatagagctaggggagttgcatgctacaattac |
49760752 |
T |
|
| Q |
301 |
aataccataacgggattttgggttttcctggtagtgcaagcttatgtttatgttaagctatgtgtgtgtctctaaagcaaaacattttgttctgttatgc |
400 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49760753 |
aataccataacgggattttgggttttcctgctagtgcaagcttatgtttatgttaagctatgtgtgtgtctctaaagcaaaacattttgttctgttatgc |
49760852 |
T |
|
| Q |
401 |
tctttgaatgtgtcacttaatagcagtttcgatctatctactacacttgctat |
453 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49760853 |
tctttgaatgtgtcacttaatagcagtttcgatctatctactacacttgctat |
49760905 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University