View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3237_high_79 (Length: 301)
Name: NF3237_high_79
Description: NF3237
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3237_high_79 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 152; Significance: 2e-80; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 152; E-Value: 2e-80
Query Start/End: Original strand, 1 - 167
Target Start/End: Original strand, 45285196 - 45285363
Alignment:
| Q |
1 |
aatattcagaaaataagtgatggaagggaaggaagat-gtgttttgtttattgaggaacgagaaaacgaggaacaggcttaaccctattttatagtgtga |
99 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
45285196 |
aatattcagaaaataagtgatggaagggaaggaagattgtgttttgcttattgaggaacgagaaaacgaggaacaggcataaccctattttatagtgtga |
45285295 |
T |
 |
| Q |
100 |
atcctaatcaactctgaagcaagggaagataaacaatgcagagagagaaagaagatactgatttgggt |
167 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45285296 |
atcctaatcaactctgaagcaagggaagataaacaatgcagagagagaaagaagatactgatttgggt |
45285363 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 81; E-Value: 4e-38
Query Start/End: Original strand, 213 - 301
Target Start/End: Original strand, 45286547 - 45286635
Alignment:
| Q |
213 |
aaaatagtaaagttgaacaaacgcgaacgaagagaaggaacaagatttggggcaaataaagaaggaacataggagggacaagacatttt |
301 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
45286547 |
aaaatagtaaagttgaacaaacgcgaacgaagagaaggaacaagatttagggcaaataaagaaggaacataggagtgacaagacatttt |
45286635 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 176 - 221
Target Start/End: Original strand, 45286186 - 45286231
Alignment:
| Q |
176 |
tagtaaaattgaacgaacatgaacgaagagaaggtaaaaaatagta |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45286186 |
tagtaaaattgaacgaacatgaacgaagagaaggtaaaaaatagta |
45286231 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University