View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3237_high_80 (Length: 298)
Name: NF3237_high_80
Description: NF3237
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3237_high_80 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 181; Significance: 8e-98; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 181; E-Value: 8e-98
Query Start/End: Original strand, 73 - 278
Target Start/End: Original strand, 2160791 - 2160992
Alignment:
| Q |
73 |
tttttccagctggagcttccggatttgggtgggtagcccaagacctcatttggacgtaccaactgggagtatttttgtgtgtgagactttggtatatgcc |
172 |
Q |
| |
|
|||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2160791 |
tttttccagctggagcttccggatttgggt----aacccaagacctcatttggacgtaccaactgggagtatttttgtgtgtgagactttggtatatgcc |
2160886 |
T |
|
| Q |
173 |
agcaaaattgaggagataaggttgagtttgggattcggattcgatgcagcatttgcacttgacagaatgagaagaattggtgggttttgaatggtcgcta |
272 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
2160887 |
agcaaaattgaggagataaggttgagtttgggattcggattcgatgcagcatttgcacttgacagaatgagaagaatcggtgggttttgaatggtcgcta |
2160986 |
T |
|
| Q |
273 |
caatgg |
278 |
Q |
| |
|
|||||| |
|
|
| T |
2160987 |
caatgg |
2160992 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 1 - 78
Target Start/End: Original strand, 2160671 - 2160748
Alignment:
| Q |
1 |
atgagagacacctaacccatatagcaacataagaaattcattgagggcattacaaaatcagaatggtgagtatttttc |
78 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
2160671 |
atgatagacacctaacccatatagcaacataagaaattcattgagggcattacaaaaccagaatggtgagtatttttc |
2160748 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University