View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3237_high_86 (Length: 282)
Name: NF3237_high_86
Description: NF3237
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3237_high_86 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 239; Significance: 1e-132; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 239; E-Value: 1e-132
Query Start/End: Original strand, 22 - 268
Target Start/End: Complemental strand, 5975287 - 5975041
Alignment:
| Q |
22 |
attctataattttggtaaaattttgtgcttattgcaaaacgtttagcacttgttatgataagttggagcaattcagaagctaagaagactaaaataagtt |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5975287 |
attctataattttggtaaaattttgtgcttattgcaaaacgtttagcacttgttatgataagttggagcaattcagaagctaagaagactaaaataagtt |
5975188 |
T |
|
| Q |
122 |
agccacaatctaaaggaactccatgatcatttggtttgaattcattgagtttgtaaccgaagcaacccaccaacaacttttgatgttgctacctaatatc |
221 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5975187 |
agccacaatctaaaggaactccatgatcatttggtttgaattcattgagtttgtaactgaagcaacccaccaacaacttttgatgttgctacctaatatc |
5975088 |
T |
|
| Q |
222 |
atacggttggagttggtgtcacaatgtcgtgaaaactattgttggtc |
268 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
5975087 |
atacggttggagttggtgtcacaatgtcgtgaaaattattgttggtc |
5975041 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University