View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3237_low_106 (Length: 258)
Name: NF3237_low_106
Description: NF3237
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3237_low_106 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 34; Significance: 0.0000000004; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 153 - 200
Target Start/End: Original strand, 48710898 - 48710942
Alignment:
| Q |
153 |
aattctctccctctttcacgtgagtttattactagacaagcaaggaac |
200 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
48710898 |
aattctctccctctttcacgtgagt---ttactagacaagcaaggaac |
48710942 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 15 - 44
Target Start/End: Original strand, 48708592 - 48708621
Alignment:
| Q |
15 |
tgtgagaaaagtccattatacccctttcac |
44 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
48708592 |
tgtgagaaaagtccattatacccctttcac |
48708621 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University