View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3237_low_112 (Length: 254)
Name: NF3237_low_112
Description: NF3237
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3237_low_112 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 232; Significance: 1e-128; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 1 - 240
Target Start/End: Original strand, 6090400 - 6090639
Alignment:
| Q |
1 |
ttaagattacaatgcttgcatatccattcatgacctttttctacttttgtaacatgaatccagcagtggttgtgtttctccccatccatgaccaaatcag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6090400 |
ttaagattacaatgcttgcatatccattcacgaccgttttctacttttgtaacatgaatccagcagtggttgtgtttctccccatccatgaccaaatcag |
6090499 |
T |
|
| Q |
101 |
ctacaagattttgatattggtatttgaaattaaaatgaatgttcatacaaaatatgataaataaacacactaaacgcaatagaaatgcgaatgtctgtct |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6090500 |
ctacaagattttgatattggtatttgaaattaaaatgaatgttcatacaaaatatgataaataaacacactaaacgcaatagaaatgcgaatgtctgtct |
6090599 |
T |
|
| Q |
201 |
tttagcaagttattatctattatatcaatagcaggttttg |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6090600 |
tttagcaagttattatctattatatcaatagcaggttttg |
6090639 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 6 - 77
Target Start/End: Original strand, 6111368 - 6111439
Alignment:
| Q |
6 |
attacaatgcttgcatatccattcatgacctttttctacttttgtaacatgaatccagcagtggttgtgttt |
77 |
Q |
| |
|
|||||||| ||||||||||||| | |||| ||||||||| |||||||||| |||||||||| | |||||| |
|
|
| T |
6111368 |
attacaataattgcatatccatttaagaccattttctactcttgtaacatgtttccagcagtgctcgtgttt |
6111439 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University